lentivirus expressing shrna constructs  (Merck & Co)

Journal: Theranostics

Article Title: The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer

doi: 10.7150/thno.101393

Figure Lengend Snippet: A RNAi screen for the identification of functional regulator of radiation-induced cell plasticity. A . schematic representation of RNAi screening strategy. B-C . Proportion of ALDH br cells in BFP + ( B ) and RFP + SUM159 cells ( C ) following silencing of each individual gene contained in the RNAi library and normalized with non-targeting siRNA (siCTRL). Genes targeted by a siRNA inducing a significant reduction of the ALDH br cell proportion are highlighted. Statistical test used is Student's t-test. Data represent mean ± SD D . Representative images of the high-content screening captures. ALDEFLUOR cellular staining is represented in green. Dead cells are labeled by DRAQ5 in red. RFP+ cells are in yellow and BFP+ cells in blue. E-F . Validation of candidate genes using FACS analysis. Proportion of ALDH br cells in BFP + ( E ) and RFP + SUM159 cells ( F ) are represented normalized with non-targeting siRNA (siCTRL). siRNA targeting ALDH1A1 was used as positive control and siRNA targeting TEXT12 or VDACL were used as negative control. Statistical test used is Student's t-test. Data represent mean ± SD. *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: To evaluate the effect of LRP4 silencing on radiotherapy-response, SUM159, S68, and MDA-MB-231 cells were first transduced with a lentivirus expressing shRNA constructs (shLRP4, #SHCLNV or shCTRL, #SHC201VN (empty vector); Merck Sigma-Aldrich)..Cells shCTRL or shLRP4 were plated at low-density (between 75 and 2000 cells per well, depending on the dose) in 12-well plates (Falcon, 353043), with 3.5mL of culture medium and irradiated between 0 and 6Gy using Synergy linear accelerator (Elekta).

Techniques: Functional Assay, High Content Screening, Staining, Labeling, Biomarker Discovery, Positive Control, Negative Control

Journal: Theranostics

Article Title: The LRP4/YAP axis drives the radiation-tolerant persister (RTP) cell state in breast cancer

doi: 10.7150/thno.101393

Figure Lengend Snippet: LRP4/YAP axis inhibition radiosensitizes iCSC. A-B . Proportion of cells ( A , SUM159; B , S68) presenting a nuclear location of YAP in each cell subpopulations five days post-irradiation, with representative images of YAP staining (in green) in each cell subpopulations on the right panel. Nuclei are counterstained with DAPi (in blue). C . Pre-ranked GSEA interrogating differential expression between iCSC and late non-CSC and YAP/TAZ target genes. D . Western blot of markers related to YAP/TAZ signaling and its activation in SUM159 and S68 cells silenced for LRP4 (shLRP4) compared to the non-targeting shRNA (shCTRL). The mean intensities are indicated below each band for each condition. E . Heat map representing the mRNA expression of the LRP4, ALDH1A1, and YAP/TAZ target genes in SUM159 and S68 silenced for LRP4 (siLRP4) compared to the non-targeting siRNA (siCTRL). Each row represents three independent replicates per conditions (R1, R2, and R3). F . Proportion of SUM159 cells presenting a nuclear location of YAP in late non-CSC and iCSC following LRP4 silencing (siLRP4) compared to a non-targeting siRNA (siCTRL). G-H . SUM159 ( G ) and S68 cells ( H ), following LRP4 silencing (shLRP4) compared to a non-targeting siRNA (shCTRL), were exposed to various dose of radiation therapy and subjected to clonogenic survival assays ( G ), with representative images (right panels). I . Patient-derived xenograft organoid (PDXO) size distribution for CRCM389 cells WT (shCTRL) or silenced for LRP4 (shLRP4) following irradiation (RT) and compared to untreated condition (CTRL) (left panel). Representative pictures of PDXO-CRCM389 7 days post-treatment (right panel). Statistical test used is Student's t-test. Data represent mean ± SD. ns (not significant), *p<0.05, **p<0.01, ***p<0.001. J . Kaplan-Meier tumor-free survival curves of mice xenografted with 100,000-200,000 SUM159 irradiated cells silenced for LRP4 (shLRP4) compared to the control (shCTRL). p-value and hazard ration (HR) estimated according to Log-rank (Mantel-Cox) test.

Article Snippet: To evaluate the effect of LRP4 silencing on radiotherapy-response, SUM159, S68, and MDA-MB-231 cells were first transduced with a lentivirus expressing shRNA constructs (shLRP4, #SHCLNV or shCTRL, #SHC201VN (empty vector); Merck Sigma-Aldrich)..Cells shCTRL or shLRP4 were plated at low-density (between 75 and 2000 cells per well, depending on the dose) in 12-well plates (Falcon, 353043), with 3.5mL of culture medium and irradiated between 0 and 6Gy using Synergy linear accelerator (Elekta).

Techniques: Inhibition, Irradiation, Staining, Quantitative Proteomics, Western Blot, Activation Assay, shRNA, Expressing, Derivative Assay, Control

Journal: Cell Genomics

Article Title: Type 1 diabetes risk genes mediate pancreatic beta cell survival in response to proinflammatory cytokines

doi: 10.1016/j.xgen.2022.100214

Figure Lengend Snippet: T1D locus 16p13 regulates beta cell survival gene SOCS1 in cytokine exposure (A) Regional plot showing T1D association for two independent signals at the DEXI/SOCS1 locus. (B) Fine mapping probabilities of the secondary signal. Variants with SNP-SELEX effect on differential TF binding and within a cytokine-responsive cCRE are highlighted in red. (C) Genome browser of the locus showing bulk ATAC-seq. Treatment abbreviations as in Figure 1 . (D) SNP-SELEX results for variant rs35342456. (E) EMSA with nuclear extract (NE) from MIN6 cells showing preferential binding to the reference allele. (F) Zoom in of the locus showing location of variant rs35342456 (yellow line) in a cytokine-responsive beta cell cCRE with co-accessibility and 3D interaction to the SOCS1 promoter in cytokine-treated and untreated EndoC-βH1 cells. For 3D interactions, virtual 4C counts are scaled between 0 and 1. (G) Counts of each sgRNA in the CRISPR-KO screen targeting SOCS1 in untreated and high-dose cytokine EndoC-βH1, normalized to the sequencing depth of each sample. Effect size and uncorrected p value from MAGeCK. (H) Normalized expression of SOCS1 in human islet samples in cytokines. Log 2 fold change and uncorrected p values from DESeq2 comparing high-dose three-cytokine (red) and untreated (purple). (I) Quantification of apoptotic EndoC-βH1 cells with shRNA targeting SOCS1 or scramble in either high-dose cytokine or vehicle (0.1% BSA). Values are mean and error bars are SD from n = 4 transductions, and p values are shown from two-way ANOVA followed by pairwise comparisons using Tukey’s HSD.

Article Snippet: Lentivirus construct expressing SOCS1 shRNA (shSOCS1) was obtained from Sigma-Aldrich (TRC# TRCN0000356244, TTTCGCCCTTAGCGTGAAGAT).

Techniques: Binding Assay, Variant Assay, CRISPR, Sequencing, Expressing, shRNA

Journal: Cell Genomics

Article Title: Type 1 diabetes risk genes mediate pancreatic beta cell survival in response to proinflammatory cytokines

doi: 10.1016/j.xgen.2022.100214

Figure Lengend Snippet:

Article Snippet: Lentivirus construct expressing SOCS1 shRNA (shSOCS1) was obtained from Sigma-Aldrich (TRC# TRCN0000356244, TTTCGCCCTTAGCGTGAAGAT).

Techniques: HiChIP, CRISPR, Amplification, Luciferase, Recombinant, Plasmid Preparation, shRNA, Software

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: Expression of LINP1 in cervical cancer tissues and cell lines a. QRT-PCR assays showing levels of LINP1 in tumor tissues and adjacent tissues from CC patients. b. Visualization of LINP1 in CC tissues using RNA-FISH analysis. c. QRT-PCR assays showing LINP1 expression levels in different CC cell lines. The expression of GAPDH served as the endogenous control.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: Expressing, Quantitative RT-PCR, Control

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: LINP1 associates with NHEJ pathway proteins Ku80 and DNA-PKcs in Hela S3 cells a. Immunoprecipitation efficiency of Ku80 and DNA-PKcs specific antibodies detected by western blots. b and c. Results from RNA-IP. QRT-PCR assays showing the relative level of LINP1 in the complex immunoprecipitated by Ku80- and DNA-PKcs-specific antibodies. d. QRT-PCR assays showing the enrichment of LINP1 with specific biotinylated oligos. e. Western blots showing the Ku80 and DNA-PKcs protein levels in the complexes pulled down by LINP1.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: Immunoprecipitation, Western Blot, Quantitative RT-PCR

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: Changes in LINP1 subcellular localization and expression levels after IR treatment a. RNA-FISH was performed using LINP1 specific biotinylated oligos to monitor the subcellular localization patterns of LINP1 in Hela S3 cells 30 minutes after irradiated with 6 Gy X-rays. b. Levels of LINP1 in the nuclear fraction measured by qRT-PCR at different time points after 6 Gy IR treatment. c. Expression of LINP1 in the whole cells 24 hours after different treatment. IH, icotinib hydrochloride; IR, ionizing radiation. Error bars, s.d. *P < 0.05 by two-tailed Student's t test; n = 3 technical replicates.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: Expressing, Irradiation, Quantitative RT-PCR, Two Tailed Test

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: Knockdown of LINP1 increased IR-induced cell apoptosis and delayed repair of DNA double-strand breaks in cervical cancer cells treated with radiation a and b. QRT-PCR assays showing LINP1 silencing efficiency using siRNA or shRNA. c. Expression of caspase3, cleaved caspase3, PARP and cleaved PARP detected by western blotting in Hela S3 cells expressing LINP1 or control siRNAs 24 hours after treated with or without 6 Gy irradiation. d. Apoptosis was detected by flow cytometry in Hela S3 cells expressing control or LINP1-specific shRNAs 24 hours after treated with 6 Gy IR. e. The apoptotic rate was calculated as the percentage of Annexin V-APC-positive cells. f. Immunofluorescence stain visualizing IR-induced γ-H2AX foci in LINP1 silencing and control Hela S3 cells 24 hours after treatment. g. Quantification of the number of γ-H2AX foci positive cells expressing LINP1 or control siRNAs 24 hours after irradiation. h. The apoptotic rate of SiHa cells expressing control vector or LINP1 24 hours after treated with or without 6 Gy irradiation. i. Immunofluorescence stain detecting α-H2AX foci in LINP1-overexpressing and control SiHa cells 24 hours after 6 Gy IR treatment. j. Quantification of the number of γ-H2AX foci positive cells expressing control vector or LINP1 24 hours after exposure to irradiation. Cells with 5 or more γ-H2AX foci were counted as unrepaired cells or γ-H2AX foci positive cells. Si-C, cells expressing Ctrl-siRNA; Si-1, cells expressing LINP1-siRNA1; Si-2, cells expressing LINP1-siRNA2. PcDNA3.1 (+) plasmid transfected SiHa cell lines were used as controls; LINP1 indicates LINP1-overexpressing SiHa cells. Error bars, s.d. * P < 0.05 by two-tailed Student's t test; n = 3 independent cell cultures.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: Knockdown, Quantitative RT-PCR, shRNA, Expressing, Western Blot, Control, Irradiation, Flow Cytometry, Immunofluorescence, Staining, Plasmid Preparation, Transfection, Two Tailed Test

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: Knockdown of LINP1 enhanced radiation sensitivity of cervical cancer cells a. Survival of control or LINP1-knockdown Hela S3 cells in response to IR treatments. Cells expressing control or LINP1 specific shRNAs were treated with different doses of IR, and the survival after treatment was measured with colony formation assays. b. Survival curve of Hela S3 cells expressing control or LINP1 specific shRNAs. Error bars, s.d.; n = 3 independent cell cultures.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: Knockdown, Control, Expressing

Journal: Cell Cycle

Article Title: LINP1 facilitates DNA damage repair through non-homologous end joining (NHEJ) pathway and subsequently decreases the sensitivity of cervical cancer cells to ionizing radiation

doi: 10.1080/15384101.2018.1442625

Figure Lengend Snippet: The main parameters of a multitarget model based on colony formation assays.

Article Snippet: The lentivirus constructs expressing LINP1 shRNA and the negative control shRNA were purchased from Shanghai Genechem Co., Ltd.

Techniques: